ID: 902974343_902974352

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 902974343 902974352
Species Human (GRCh38) Human (GRCh38)
Location 1:20078165-20078187 1:20078194-20078216
Sequence CCTGAAGGACTGAGGAGGTGACC CTTGGGCTATGCCAGGCTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 159} {0: 1, 1: 0, 2: 1, 3: 18, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!