|
Left Crispr |
Right Crispr |
| Crispr ID |
902974474 |
902974483 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:20078981-20079003
|
1:20079022-20079044
|
| Sequence |
CCCACTGTAGTCTCAGCTACTCG |
GAAGATGGCTTGAGCCCAGGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 36, 2: 574, 3: 1809, 4: 2757} |
{0: 82, 1: 1352, 2: 8218, 3: 25236, 4: 100083} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|