|
Left Crispr |
Right Crispr |
Crispr ID |
902974475 |
902974480 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:20078982-20079004
|
1:20079000-20079022
|
Sequence |
CCACTGTAGTCTCAGCTACTCGA |
CTCGAGAGGCAGAGGCAGGAGGG |
Strand |
- |
+ |
Off-target summary |
{0: 3, 1: 49, 2: 800, 3: 2267, 4: 3280} |
{0: 1, 1: 15, 2: 157, 3: 1002, 4: 2899} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|