ID: 902984679_902984690

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 902984679 902984690
Species Human (GRCh38) Human (GRCh38)
Location 1:20148396-20148418 1:20148427-20148449
Sequence CCCTAGAGCCTCTGAGGTTTGAG CGGGAGGAGGGTCTGGCTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 171} {0: 1, 1: 0, 2: 2, 3: 24, 4: 286}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!