ID: 902986622_902986628

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 902986622 902986628
Species Human (GRCh38) Human (GRCh38)
Location 1:20158423-20158445 1:20158454-20158476
Sequence CCTCCAAGTGCATGGGGCATTAT AAAGGCCCATTGAAATCTGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 56, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!