ID: 902990810_902990827

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 902990810 902990827
Species Human (GRCh38) Human (GRCh38)
Location 1:20186028-20186050 1:20186074-20186096
Sequence CCAGGCCGGTTCCGGTCACGCCG CGGCGTTGCCCGGGAGACCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 40} {0: 1, 1: 1, 2: 0, 3: 5, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!