ID: 903008327_903008331

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 903008327 903008331
Species Human (GRCh38) Human (GRCh38)
Location 1:20312959-20312981 1:20312972-20312994
Sequence CCTCCCATGTTCGATCCCCAACA ATCCCCAACAGTCACAGGTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 68} {0: 1, 1: 0, 2: 0, 3: 8, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!