ID: 903019792_903019796

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 903019792 903019796
Species Human (GRCh38) Human (GRCh38)
Location 1:20386063-20386085 1:20386078-20386100
Sequence CCTTCTGCCCTCCAGAAACACAG AAACACAGACCATCAACCCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 45, 4: 456} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!