ID: 903023785_903023788

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 903023785 903023788
Species Human (GRCh38) Human (GRCh38)
Location 1:20412548-20412570 1:20412565-20412587
Sequence CCAACTCAGAGCAGCCTTACCTT TACCTTGATCTGTCTTAGACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 215} {0: 1, 1: 0, 2: 0, 3: 5, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!