ID: 903027305_903027316

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 903027305 903027316
Species Human (GRCh38) Human (GRCh38)
Location 1:20438533-20438555 1:20438571-20438593
Sequence CCGTGGTATGAGCTGCCCTATTT AAGGAAATGAAGGCGGCTTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 23, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!