|
Left Crispr |
Right Crispr |
| Crispr ID |
903050020 |
903050028 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:20593816-20593838
|
1:20593850-20593872
|
| Sequence |
CCTCCCACCTTGGCCTCACACAG |
CAGGCATGAGCCACTGCACCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 387, 2: 24259, 3: 78013, 4: 159144} |
{0: 6440, 1: 26478, 2: 70922, 3: 127775, 4: 147131} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|