ID: 903056212_903056226

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 903056212 903056226
Species Human (GRCh38) Human (GRCh38)
Location 1:20637990-20638012 1:20638043-20638065
Sequence CCCAGAACCTGGAGGTGACAAAG GGTACCAGTGCACCAGGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 272} {0: 1, 1: 0, 2: 1, 3: 10, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!