ID: 903056880_903056897

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 903056880 903056897
Species Human (GRCh38) Human (GRCh38)
Location 1:20642155-20642177 1:20642207-20642229
Sequence CCCTGCTCTCTCCCCAGCACCGT CCATTGTTATGCAGCAAAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 507} {0: 1, 1: 0, 2: 3, 3: 6, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!