ID: 903059200_903059204

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 903059200 903059204
Species Human (GRCh38) Human (GRCh38)
Location 1:20657790-20657812 1:20657822-20657844
Sequence CCTCTCATGCTACATTCAAAAAG TACTCTCCTTTGGAGAGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 140} {0: 1, 1: 0, 2: 1, 3: 15, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!