ID: 903065148_903065163

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 903065148 903065163
Species Human (GRCh38) Human (GRCh38)
Location 1:20695586-20695608 1:20695616-20695638
Sequence CCAACCCTCCTCTCCCCCCACAT CTGGTAAGTCACAGAGAACAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 114, 4: 1351} {0: 1, 1: 0, 2: 3, 3: 29, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!