ID: 903068268_903068276

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 903068268 903068276
Species Human (GRCh38) Human (GRCh38)
Location 1:20713433-20713455 1:20713471-20713493
Sequence CCACAATGGGTCTGCACCCACCT TGTCAGCCCCAAGGAGGTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 180} {0: 1, 1: 0, 2: 1, 3: 21, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!