ID: 903099871_903099874

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 903099871 903099874
Species Human (GRCh38) Human (GRCh38)
Location 1:21019910-21019932 1:21019957-21019979
Sequence CCCCATGAACATAATCAAGAAAC GAAAATAATTCCTCTACTACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 320} {0: 1, 1: 0, 2: 1, 3: 17, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!