ID: 903104320_903104324

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 903104320 903104324
Species Human (GRCh38) Human (GRCh38)
Location 1:21062165-21062187 1:21062198-21062220
Sequence CCTCTCGTTTCAGCCTCCCAAGT ACATGTGTGTGCCACTACACTGG
Strand - +
Off-target summary {0: 1, 1: 27, 2: 732, 3: 6876, 4: 31646} {0: 1, 1: 10, 2: 92, 3: 800, 4: 2789}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!