ID: 903104321_903104324

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 903104321 903104324
Species Human (GRCh38) Human (GRCh38)
Location 1:21062178-21062200 1:21062198-21062220
Sequence CCTCCCAAGTAGTTAAAACTACA ACATGTGTGTGCCACTACACTGG
Strand - +
Off-target summary {0: 1, 1: 51, 2: 1042, 3: 11790, 4: 77901} {0: 1, 1: 10, 2: 92, 3: 800, 4: 2789}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!