|
Left Crispr |
Right Crispr |
Crispr ID |
903104321 |
903104324 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:21062178-21062200
|
1:21062198-21062220
|
Sequence |
CCTCCCAAGTAGTTAAAACTACA |
ACATGTGTGTGCCACTACACTGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 51, 2: 1042, 3: 11790, 4: 77901} |
{0: 1, 1: 10, 2: 92, 3: 800, 4: 2789} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|