|
Left Crispr |
Right Crispr |
| Crispr ID |
903104321 |
903104328 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:21062178-21062200
|
1:21062229-21062251
|
| Sequence |
CCTCCCAAGTAGTTAAAACTACA |
GTTTTATTTTTTGGTGAGACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 51, 2: 1042, 3: 11790, 4: 77901} |
{0: 1, 1: 6, 2: 150, 3: 3079, 4: 41599} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|