|
Left Crispr |
Right Crispr |
| Crispr ID |
903104323 |
903104329 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:21062182-21062204
|
1:21062230-21062252
|
| Sequence |
CCAAGTAGTTAAAACTACATGTG |
TTTTATTTTTTGGTGAGACAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 38, 3: 692, 4: 8073} |
{0: 4, 1: 74, 2: 2019, 3: 28708, 4: 126396} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|