ID: 903125637_903125641

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 903125637 903125641
Species Human (GRCh38) Human (GRCh38)
Location 1:21245540-21245562 1:21245569-21245591
Sequence CCAGCCAGGCCAAGCTTTCCATG GCTCCTACTGCCCCACCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 215} {0: 1, 1: 0, 2: 0, 3: 28, 4: 286}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!