ID: 903130977_903130996

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 903130977 903130996
Species Human (GRCh38) Human (GRCh38)
Location 1:21279373-21279395 1:21279417-21279439
Sequence CCCGGGCCCCGCTTCCCTTGGAG CAGGCCCTGGAGAGGCATCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 27, 4: 280} {0: 1, 1: 0, 2: 4, 3: 55, 4: 477}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!