ID: 903171478_903171492

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 903171478 903171492
Species Human (GRCh38) Human (GRCh38)
Location 1:21557197-21557219 1:21557244-21557266
Sequence CCTTCCCCACACTCCAGTGTCTC CTCCCGCTTAGGGTCATCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 55, 4: 581} {0: 1, 1: 0, 2: 0, 3: 1, 4: 43}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!