ID: 903172996_903173003

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 903172996 903173003
Species Human (GRCh38) Human (GRCh38)
Location 1:21565149-21565171 1:21565168-21565190
Sequence CCTTCAGCCCTCCATGCACTGCC TGCCCCCCACAAATTTCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 44, 4: 366} {0: 1, 1: 0, 2: 1, 3: 10, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!