ID: 903179171_903179184

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 903179171 903179184
Species Human (GRCh38) Human (GRCh38)
Location 1:21596945-21596967 1:21596977-21596999
Sequence CCTTGTTCCCTCTGAGTCCAGAG GGGGTGATGGAGGCCCAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 323} {0: 2, 1: 0, 2: 5, 3: 120, 4: 869}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!