|
Left Crispr |
Right Crispr |
| Crispr ID |
903184903 |
903184910 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:21623284-21623306
|
1:21623324-21623346
|
| Sequence |
CCTCTCTGGACCTCAGTTTCCCC |
ACTCTGTAGGCCCTTCCAGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 8, 1: 188, 2: 962, 3: 3166, 4: 7042} |
{0: 1, 1: 0, 2: 2, 3: 17, 4: 118} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|