ID: 903189007_903189017

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 903189007 903189017
Species Human (GRCh38) Human (GRCh38)
Location 1:21646027-21646049 1:21646066-21646088
Sequence CCACTTCCCCTCTCTGAGCGTCA AATGGGGATGGACAGTAGTAAGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 50, 3: 242, 4: 778} {0: 1, 1: 0, 2: 1, 3: 15, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!