|
Left Crispr |
Right Crispr |
| Crispr ID |
903189008 |
903189011 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:21646033-21646055
|
1:21646048-21646070
|
| Sequence |
CCCCTCTCTGAGCGTCAGTTCCC |
CAGTTCCCTCATCTGTAAAATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 3, 2: 69, 3: 406, 4: 1128} |
{0: 37, 1: 931, 2: 4071, 3: 9755, 4: 16832} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|