|
Left Crispr |
Right Crispr |
| Crispr ID |
903197120 |
903197123 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
1:21699032-21699054
|
1:21699067-21699089
|
| Sequence |
CCCAAATGCATGTACATGCACAG |
TCGCCCAAGCTGGAGTGCAGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 2, 3: 30, 4: 238} |
{0: 1326, 1: 70153, 2: 225370, 3: 246825, 4: 153730} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|