ID: 903211779_903211790

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 903211779 903211790
Species Human (GRCh38) Human (GRCh38)
Location 1:21822897-21822919 1:21822949-21822971
Sequence CCCGTCTCAGGTAGCTGTGGGGC TAGGAGTGAGAACTGCCCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 182} {0: 1, 1: 0, 2: 1, 3: 15, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!