ID: 903216662_903216670

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 903216662 903216670
Species Human (GRCh38) Human (GRCh38)
Location 1:21847285-21847307 1:21847322-21847344
Sequence CCTGAAAGTTCCTTCTCCCCAGG GCATCCCTCGTCCCTTTCCTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 29, 4: 256} {0: 1, 1: 0, 2: 1, 3: 18, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!