ID: 903217840_903217845

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 903217840 903217845
Species Human (GRCh38) Human (GRCh38)
Location 1:21852888-21852910 1:21852907-21852929
Sequence CCAGCAAGGTGGTCCCGGGGGGC GGGCTGCCATACCTGGTGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 118} {0: 1, 1: 0, 2: 4, 3: 20, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!