ID: 903219659_903219665

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 903219659 903219665
Species Human (GRCh38) Human (GRCh38)
Location 1:21862091-21862113 1:21862111-21862133
Sequence CCCCTGCGGCGTTGTGCTGGCAT CATTGCTGCAGGGCACAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 49} {0: 1, 1: 0, 2: 0, 3: 14, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!