ID: 903219659_903219668

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 903219659 903219668
Species Human (GRCh38) Human (GRCh38)
Location 1:21862091-21862113 1:21862130-21862152
Sequence CCCCTGCGGCGTTGTGCTGGCAT GAGGGCAGGCACCAGCCATTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 49} {0: 1, 1: 0, 2: 0, 3: 42, 4: 346}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!