ID: 903241792_903241796

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 903241792 903241796
Species Human (GRCh38) Human (GRCh38)
Location 1:21987580-21987602 1:21987604-21987626
Sequence CCATCTGGTTCTGCACCAAGTTT GCATCCATGTGGTGACCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 190} {0: 1, 1: 3, 2: 75, 3: 94, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!