ID: 903241792_903241803

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 903241792 903241803
Species Human (GRCh38) Human (GRCh38)
Location 1:21987580-21987602 1:21987621-21987643
Sequence CCATCTGGTTCTGCACCAAGTTT TCCTGGGAGTGGGGACCACCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 18, 4: 190} {0: 3, 1: 4, 2: 6, 3: 29, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!