ID: 903241795_903241808

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 903241795 903241808
Species Human (GRCh38) Human (GRCh38)
Location 1:21987595-21987617 1:21987635-21987657
Sequence CCAAGTTTGGCATCCATGTGGTG ACCACCAGGTGGCCTAAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 10, 4: 97} {0: 2, 1: 80, 2: 128, 3: 129, 4: 265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!