ID: 903241798_903241803

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 903241798 903241803
Species Human (GRCh38) Human (GRCh38)
Location 1:21987608-21987630 1:21987621-21987643
Sequence CCATGTGGTGACCTCCTGGGAGT TCCTGGGAGTGGGGACCACCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 6, 4: 131} {0: 3, 1: 4, 2: 6, 3: 29, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!