ID: 903241798_903241806

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 903241798 903241806
Species Human (GRCh38) Human (GRCh38)
Location 1:21987608-21987630 1:21987631-21987653
Sequence CCATGTGGTGACCTCCTGGGAGT GGGGACCACCAGGTGGCCTAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 6, 4: 131} {0: 2, 1: 55, 2: 125, 3: 155, 4: 302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!