ID: 903251237_903251244

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 903251237 903251244
Species Human (GRCh38) Human (GRCh38)
Location 1:22054300-22054322 1:22054328-22054350
Sequence CCGCCTCCCGGGGTCAAGTGAGC ACCTCAGCCTCCCGAGTAGCTGG
Strand - +
Off-target summary {0: 1, 1: 7, 2: 555, 3: 13767, 4: 61708} {0: 6311, 1: 132274, 2: 300665, 3: 217345, 4: 143708}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!