|
Left Crispr |
Right Crispr |
Crispr ID |
903251237 |
903251247 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:22054300-22054322
|
1:22054337-22054359
|
Sequence |
CCGCCTCCCGGGGTCAAGTGAGC |
TCCCGAGTAGCTGGTACTGCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 7, 2: 555, 3: 13767, 4: 61708} |
{0: 10, 1: 1920, 2: 64223, 3: 191415, 4: 274745} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|