ID: 903252431_903252432

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 903252431 903252432
Species Human (GRCh38) Human (GRCh38)
Location 1:22065592-22065614 1:22065609-22065631
Sequence CCAGTTGCTTTATATACATTACC ATTACCTCATTTCTCTGTAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 319} {0: 1, 1: 0, 2: 1, 3: 12, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!