ID: 903260083_903260092

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 903260083 903260092
Species Human (GRCh38) Human (GRCh38)
Location 1:22126923-22126945 1:22126971-22126993
Sequence CCTTCCTCCATCTGCCTCACCAG GTGCTTCCCTCTCAGACCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 60, 4: 698} {0: 1, 1: 0, 2: 2, 3: 20, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!