ID: 903261696_903261706

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 903261696 903261706
Species Human (GRCh38) Human (GRCh38)
Location 1:22135053-22135075 1:22135097-22135119
Sequence CCCTCTGAGGCTGGGGAGTGTGA GCTGCTAGGACATCAAGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 274} {0: 1, 1: 0, 2: 0, 3: 8, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!