ID: 903274657_903274674

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 903274657 903274674
Species Human (GRCh38) Human (GRCh38)
Location 1:22212880-22212902 1:22212921-22212943
Sequence CCCTCTCTCCGGGGAGGATGTGC CACGCTAATCCTCTGGGGAGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 8, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!