ID: 903276536_903276540

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 903276536 903276540
Species Human (GRCh38) Human (GRCh38)
Location 1:22225672-22225694 1:22225687-22225709
Sequence CCAGTTTGGAATAGGGTGTATGC GTGTATGCCGGGTGAAAACTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 5, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!