ID: 903287615_903287626

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 903287615 903287626
Species Human (GRCh38) Human (GRCh38)
Location 1:22286583-22286605 1:22286628-22286650
Sequence CCCAGAGGGGTTCCTTGGGGACA CCAGTGAGGGGGCCCTCAGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 12, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!