ID: 903287625_903287634

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 903287625 903287634
Species Human (GRCh38) Human (GRCh38)
Location 1:22286628-22286650 1:22286652-22286674
Sequence CCAGTGAGGGGGCCCTCAGTTGG GTTGCCTGGGGGTCTGGCCGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 18, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!