ID: 903299361_903299370

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 903299361 903299370
Species Human (GRCh38) Human (GRCh38)
Location 1:22367332-22367354 1:22367381-22367403
Sequence CCACAACTCCCCTTAATGAATTC CTGCTGGGGTTGTGGAGAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 134} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!